This allele from project TCPR0415 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and single guide RNAs with spacer sequences of AGCACACAAGCTTGATAAAC and GTGTAGGACTGTCTGCATGC targeting the 5' side and GTTCTACTCATGCCTTCCAA and ATAGTAATGGCCAAACGAGA targeting the 3' side of exons 9-11 (ENSMUSE00000272786, ENSMUSE00000272778, and ENSMUSE00000471272) resulting in a 1,067-bp deletion in Chr10:128115947 to 128117012, and insAAGCA (GRCm38). (J:165963)