Ap2s1^em1(IMPC)Tcp

This allele was produced in project TCPR0357 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GCAAGACGCGCCTGGCCAAG and GATCGAGGAGGTGCACGCCG. This resulted in a 58-bp deletion in chromosome 7 from 16743267 to 16743324 (GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 18 and early truncation 47 amino acids later (p.K18Pfs*49). (J:165963)