Mpz^em1(IMPC)Tcp

This allele from project TCPR0238 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and one guide RNA with the spacer sequence TCTTGCCCACTATGTCCGGT and an oligonucleotide repair template. Non-homologous end-joining repair resulted in a 19 bp deletion from Chr1:171158916 to 171158934 in ENSMUSE00000476648. This mutation is predicted to cause a frameshift with amino acid changes after residue 134 and early truncation 20 amino acids later (p.D134Lfs*22). The repair template was not integrated. (GRCm38). (J:165963)