Ofcc1^em1(IMPC)J

This allele from project Ofcc1- 7447J-M8483 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGCCTGACCAAATCCATG, GCAACGCCAGTGAACATGTA, TCTTTCTTATATGGAATAAG, and AGTCAATGTTAAAACAATGA, which resulted in a 435 bp deletion spanning exon 5 beginning at Chromosome 13 negative strand position 40,255,271 bp, TTATTCCATATAAGAAAGAAA and ending after TCCTATCTTTCCACATGGAT at 40,255,271 bp (GRCm38/mm10). This mutation deletes exon 5 and 268 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause amino acid sequence change after residue 114 and early truncation 4 amino acids later. (J:188991)