This allele from project Hsbp1l1-7411J-M303 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCTCCCAGGATTTACAT, TTAGGGTGTTCGGTAAGAAG, GACATTGTAAATACATACCG and TATTTGTTTAGGTTAGTCCA, which resulted in a 169 bp deletion spanning exon 3 beginning at Chromosome 18 negative strand position 80,235,598 bp, GTCCACGGTATGTATTTAC, and ending after AATATCCTTTCCTCTTCTTA at 80,235,430 bp (GRCm38/mm10). This mutation deletes exon 3 and 102 bp of intronic sequence including the splice acceptor and donor. There is an additional 22 bp deletion in intron 4, which will not affect the exon deletion. This mutation is predicted to cause a change in amino acid sequence after 17 residues and early truncation 18 amino acids later. (J:188991)