This allele from project Kcnb2-6924J-M9857 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGCTTCCCCAGGCGTGTCCG, with a non-contributing plasmid, which resulted in an 8 bp deletion (CCGGACAC) in exon1 beginning at Chromosome 1 positive strand position 15,312,622 bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 57 and early truncation 7 amino acids later. (J:188991)