This allele from project Vwa5a- 7101J M#8480 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CCAGAACTACTCCTCATCTA, GGCGACCTTTGTGTTTCCTA, TGGGCACATAGTAATTAAAA, which resulted in a 376 bp deletion in intron 3 beginning at Chromosome 9 positive strand position 38,722,488 bp, CTATGGGTGTTACTCTAGAAAAGC, and ending after GTTCTTTTATTCATTCCCTTT at 38,722,863 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to result in amino acid sequence change after residue 14 and early truncation 5 amino acids later. (J:188991)