This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, TTACGGTAAGTCCAAGCGAT and TTGAAAGGCTCGAGCTACAG, which resulted in a 94 bp deletion beginning in exon 2 at Chromosome 15 position 9,083,375 bp, CCATCGCTTGGACTTACCGTA, and ending after GTAGTCCACTGTAGCTCGAGCC at 9,083,282 bp (GRCm38/mm10) in intron 2. This 94 bp deletion begins after the initial 12 bp of coding sequence of exon 2 and includes 77 bp of exon 2 then 17 bp of intron 2 including the splice donor sequence, and is predicted to cause a read-through into intron 2, which results in amino acid sequence changes after amino acid 92 and early truncation 18 amino acids later. (J:188991)