This allele from project E130311K13RIK-7012J-M2RMP1 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AACAACTGTAGTGATTGTTA, AGAAAGAAAGTTAAACTACG, and TGTCTTCTTGTTAAATGCTT, which resulted in a 139 bp deletion beginning in intron 3 at Chromosome 3 negative strand position 63,925,555 bp, TAAATGCTTAGGTATCTTCACAT, and ending after AAGAAAGAAAGTTAAACTACG at 63,925,417bp(GRCm38/mm10) in exon 3. This mutation deletes the splice acceptor as well as 64bp from exon 3 essentially removing the entire exon. This mutation is predicted to result in amino acid sequence change after 58 residues and early truncation 13 amino acids later. (J:188991)