Egfem1^em1(IMPC)J

This allele from project Egfem1-6963J-F4337 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GCAGGGTTTGAATTAGAGGG, TGGGAGGTAGACGAATAAGA, GACAAGTTATATGTTACAAG, CTTGTAACATATAACTTGTC, which resulted in a 273bp deletion beginning in intron 3 at Chromosome 3 positive strand position 29,151,713 bp, ATTCGTCTACCTCCCAATGTATGT, and ending after CTTCCTGACAAGTTATATGTTAC at 29,151,985 bp (GRCm38/mm10) in intron 4. This mutation results in the deletion of exon3 and is predicted to cause a change in amino acid sequence after residue 74 and early truncation 35 amino acids later. (J:188991)