This allele from project Abca16-6894J-M2454 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GTTTCATCTCTAAAGTCACT, TAACTTGTCTGGCCACCAGA and CAAGCTACTACTGTTATGCC, which resulted in a 112 bp deletion beginning in intron 2 at Chromosome 7 positive strand position 120,431,039 bp, at ACTTGGTTTTCTACTGGGATGTA, and ending after TTGGTGCACAGAGGACCATCT at position 120,431,150 bp in exon 2 (GRCm38). This mutation deletes 43 bp in exon 2 as well as the splice acceptor to essentially delete the exon. This mutation is predicted to cause amino acid sequence changes after residue 20 and early truncation 43 amino acids later. (J:188991)