This allele from project Kcnd3- 6780J-M7405 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TGTTCGAGCAAGTGAGTGAT, TGGTGCCTAAGACAATCGCA and GCATGGACGTCCTCTCACT which resulted in a 327bp deletion beginning in intron 3 at GTTTCCCACATGGCCTCTTA at Chromosome 3 positive strand position 105,658,545 bp (GRCm38) and ending after TAAGTAAGAGGCCATGTGGGAAAC at position 105,658,871 bp in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 369 and early truncation 32 amino acids later. (J:188991)