This allele from project Klra7-6781J-M7991 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: TCTTGTACTTGTGCATAACC, CAGTCCTCACTAGTTTCTGC and GACATGGACTGACCAAATT which resulted in a 241 bp deletion beginning in 5 upstream sequence at Chromosome 6 negative strand position 130,231,784 bp, beginning TCAGGGTGTTTATAGCATTAAG, and ending after GTTGCAGAAACTAGTGAGGAC in exon 1 at 130,231,544 bp (GRCm38/mm10). This mutation deletes the 5-prime UTR region and part of exon 1 and is predicted to not produce a protein product. (J:188991)