This allele from project Med20-6705J-M5886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, AGGAACTCTTGGGGACTGAT and GCTTAGAGTATTTACGTTAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 348bp deletion beginning in intron 1 at GGGGACTGATGGGTGGGGAT at Chromosome 17 positive strand position 47,612,827 bp (GRCm38) and ending after GCTTAGAGTATTTACGTTAAT at position 47,613,174 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites. (J:188991)