This allele from project Ddx59-6150J-MP92R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCAGCAAGTGCTTGACGTTT, which resulted in an 8 bp deletion TTGACGTT in exon 5 beginning at Chromosome 1 positive strand position 136432352bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 368 and early truncation 5 amino acids later. (J:188991)