This allele from project Nxn-6439J-FP22R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GCGTCTAGGAATATTAGCGA, ACTCTGCAATTAATTTGGTT and TGACCCGGAAGGTAAGGCTT which resulted in a 5 bp deletion ATCGC in exon 2 beginning at Chromosome 11 negative strand position 76278553bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 133 and early truncation 21 amino acids later. (J:188991)