This allele from project Poc1a-5675J-3728 was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GGCAAGAAGGTGTCCCGATG and GAGACAAGACTGTTCGCATC, which resulted in a 30 bp deletion CTCCCCATCGGGACACCTTCTTGCCTCAGG in exon3 beginning at Chromosome 9 positive strand position 106,284,984 - 106,285,013 bp (GRCm38). This mutation is predicted to cause a 10 amino acid in-frame deletion after residue 70. (J:188991)