This allele from project Adad1-6098-103P6MR was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CTTTCAGAGGAATATCCAGT and AAGTTGTAGTCTGTCGAATA, which resulted in a 29 bp deletion ATATTCCTCTGAAAGTTGTAGTCTGTCGA in exon 2 beginning at Chromosome 3 positive strand approximate position 37,064,302 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 81 and an early truncation 9 amino acid later. (J:188991)