This allele from project Prss56-6052-104P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCCCCAGGTCACCATGCCGC, which resulted in a 1 bp insertion (G) after exon1 beginning at Chromosome 1 positive strand position 87183497 bp (GRCm38), which is after the sequence GGTCACCATGC. This mutation is predicted to cause amino acid sequence changes after residue 2 and early truncation 66 amino acids later. (J:188991)