This allele from project Pcdh12-6034J-P3MB was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GTAGCATCATGCTTACCGGC and CATTCCTGCTAGGGCTCTTA, which resulted in a 38 bp deletion GCCATTCCTGCTAGGGCTCTTAGGGCCAGGAAGCTACT in exon1 beginning at Chromosome 18 negative strand position 38,284,057 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 63 amino acids later. (J:188991)