Zfp219^em1(IMPC)J

This allele from project Zfp219-6028J-P3MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GATCTGCAGCGCTACTCCAA, which resulted in a 19 bp deletion CGCTACTCCAACGGACCAG in exon 2 beginning at Chromosome 14 negative strand position 52,009,555 bp (GRCm38), which is predicted to cause amino acid sequence changes after residue 25 and early truncation 46 amino acids later. (J:188991)