This allele from project Dolk-5942-1899 was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CGTAGAAGGCCTGCACCGCG and ACGTCCAGTACAAGTGGGAC, which resulted in a 25 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 30285881 (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 50 and early truncation 32 amino acids later. (J:188991)