This allele from project Stk36-5876J-2652 was generated at The Jackson Laboratory by injecting Cas9 D10 nickase RNA and guide sequences CGAGAGATTGAAATCATGCG and TTTCTCTGAGCGCCCCAGTT, which resulted in an 8 bp deletion (AAATCATG) in exon 3 beginning at Chromosome 1 positive strand position 74603211bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and early truncation 15 amino acids later. (J:188991)