This allele from project Bmp2k-5786J-8977 was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and left guide sequence GGCGAACACCCGGACCCCCA and right guide sequence CGGCCGCTACCAGGTCACCC, which resulted in an 163 bp deletion in exon1 beginning at CGCGGGCGGCGGGCTCGGCGGCG at Chromosome 5 positive strand position 96,997,992 bp (GRCm38/mm10) and extending through CGGGGTGTGGCGGCGGCTGCGGGGCC at 96,998,155 bp and is predicted to cause a frameshift mutation with early truncation. (J:188991)