This allele from project Eogt-5785J-8958 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTGAGGCTGACGATGCGCC, which resulted in a 25 bp deletion AGGCTGACGATGCGCCTGGCAAGGC in exon 4 beginning at Chromosome 6 negative strand position 97145373 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)