Exon 2 was replaced with one in which coding nucleotide 437 (T), the second base in valine codon 146 at the start of the second poly-alanine stretch, was replaced with a C and had a duplication of nucleotides coding for poly-alanine sequence inserted after it (c.437T>CGGCTGCCGCCGCTGCCGCTGCAGC). Note that this duplicated sequence cannot be found as a contigous sequence in either C57BL/6J or 129S1/SvImJ, but rather as two separate sequences in two separate poly-alanine stretches in exon 2. This results in a protein with a longer second poly-alanine repeat (p.(V146delinsAAAAAAAAA)). A neomycin resistance cassette was inserted into intron 1. Western blot analysis showed reduced protein expression. (J:152416)