his allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNAs with the spacer sequences TGCTCTGATATCTAATATTG and GAACCACGAGAGTTGGTCAT. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exons ENSMUSE00000337447, ENSMUSE00000360581, and ENSMUSE00000341974 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:344138)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count