This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence CTCCAATCACCAGGTCGAAT and a single-strand oligonucleotide encoding the changes c.2113-2114CC>GT [p.P705A] and c.2116-2117TG>GA [p.C706D], and c.2085C>A to inactivate the PAM sequence and prevent re-cutting of the repaired allele in ENSMUST00000020991 (GRCm39).
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count