This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences AGGTGGCGCTGACTTAACAT and GACACTAGGGACAACAACTG and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking the coding region; the 5' loxP site is upstream of the first coding exon (ENSMUSE00000639008) and the 3' loxP is 16bp 3' of the stop codon (GRCm38). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele.
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count