This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TATGTAATCGGCAACATCGC targeting the 5' side and AAACTCTACCTCAGGTTCGA targeting the 3' side of a critical region (ENSMUSE00000494738). This resulted in a 3950-bp deletion of Chr3 from 103242223 to103245812 (GRCm39) introducing a frameshift and a premature stop codon. (J:344138)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count