Glycine codon 54 (GGC) was changed to arginine (AGA) (p.G54R) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTAGGG) and an ssODN templete using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.G58R mutation found in a family with mitochondrial myopathy. (J:344465)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count