Serine codon 87 (TCA) in exon 6 was changed to leucine (TTA) (c.C260T, p.S87L) using sgRNAs (targeting AGTGGACTCAGGAGTTCTTTTGG and TTTTGGCTGACTTCCCAAACTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with Charcot-Marie-Tooth disease type 2Z (CMT2Z) and developmental delay, impaired growth, dysmorphic facies and axonal neuropathy (DIGFAN). (J:341847)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count