Arginine codon 235 (CGG) in exon 8 was changed to tryptophan (TGG) (p.R235W) using sgRNAs (targeting CTTACCCAGAGAGGAAGATC, GTCATCCGGATCTTCCTCTC, and TCATCCGGATCTTCCTCTCT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of common human SNP rs10109853 (p.R248W) that renders the encoded peptide catalytically inactive. (J:342726)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count