This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAATGTCCAAAATTAGTCA and ACCTGTTTATCCAAACAACG. This resulted in a 1086 bp deletion of Chr13:23,904,591-23,905,676 (GRCm38/mm10) that removes exons ENSMUSE00000491519, ENSMUSE00000517959, and ENSMUSE00000518852. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count