This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CATAGAACATAATCTGAAGG and CATCCAGCATTAGGCTCAGG. This resulted in a 692 bp deletion of Chr7:4,642,957-4,643,648(GRCm38/mm10) that removes exons ENSMUSE00000415805, ENSMUSE00000415802, and ENSMUSE00000415797. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count