This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CGGCCATCTCAGTGCAGACA and CCGTGGGACATCCTCCGTGT. This resulted in a 21,994 bp deletion of Chr6:40,443,966-40,465,959 (GRCm38/mm10) removing exons ENSMUSE00000266547, ENSMUSE00000266539, ENSMUSE00000416138, ENSMUSE00000266530, ENSMUSE00000266525, ENSMUSE00000266519, ENSMUSE00000266519, ENSMUSE00000266506, ENSMUSE00000266499, ENSMUSE00000266493, ENSMUSE00000266485 (exons 2-12) that contain the entire protein coding sequence. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count