This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTTCCTGCTGACTATCCCTG and GTGAGGATACCGAGGCAGGG. This resulted in a 2,287 bp deletion of Chr15:81,946,521-81,948,807 (GRCm38/mm10) that removes exons ENSMUSE00000252667 and ENSMUSE00000556790. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count