Lysine codon 1256 (or 1257, 1258, 1259) (AAG) in exon 28 was deleted (p.K1256del) using gRNAs (targeting CCAGGCGAAGCAGGAGGTGGAAC and CCTGCAGCTGCACCTCCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with familial thoracic aortic aneurysms and dissections (FTAAD). (J:344092)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count