This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein with guide RNAs having the spacer sequences CTATGATAGATAGTGCCCAT and CTGATCTTAGAATATCAATT. Recombinant AAV was used to deliver a single repair template containing the loxP sites, critical region, and flanking homology arms. The resulting allele has loxP sites flanking exon 8 (ENSMUSE00000334936) (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count