Threonine exon 90 (ACG) in exon 3 was changed to isoleucine (ATA) (p.T90I) using a crRNA (targeting CCTTTACGGCTTCCCAGAATTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation with unknown significance in relation to tumor necrosis factor (TNF) receptor-associated periodic syndrome (TRAPS). (J:342733)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count