Alanine codon 393 (GCT) in exon 7 was changed to threonine (ACT) (p.A393T) using an sgRNA (targeting CCCAATATTATATTTGCACTCGC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of human SNP rs13107325 (GRCh38:chr4:102267552C>T, c.1171G>A, p.A391T) associated with schizophrenia. (J:342738)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count