Serine codon 351 (TCT) was changed to glutamic acid (GAG) (p.S351E) using a pegRNA (containing target-binding sequence GACUGGAGUUCACCUGUAGA and template GUGGACCCAGAG) with the prime editing system. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphomimetic, rendering the peptide permanently activated. (J:342766)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count