A 21 bp deletion was created in exon 4 (CAGACAGCCACCAGCCTATGG) using an sgRNA (targeting GCAGACAGCCACCAGCCTATGGG) and an ssODN template with CRISPR/Cas9 technology. The in-frame deletion, at the 5' end of the exon, may affect the splice acceptor site and deletes codons for critical residues in the encoded peptide. (J:342770)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count