Cysteine codon 498 (TGT) in exon 7 was targeted for change to phenylalanine (TTT) (c.1493G>T, p.C498F) using an sgRNA (targeting CACACAGCAGCAGATGCTCCAGG) and an ssODN template with CRISPR/Cas9 technology. This allele contains an unintended 7 bp deletion in exon 7 (c.1476_1482delGGAGCAT), leading to a frameshift and premature stop codon (p.E493fs*28). (J:342770)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count