Cysteine codon 498 (TGT) in exon 7 was changed to phenylalanine (TTT) (c.1493G>T, p.C498F) using an sgRNA (targeting CACACAGCAGCAGATGCTCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.1499G>T (p.C500F) mutation associated with primary ciliary dyskinesia (PCD). (J:342770)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count