Histidine codon 186 (CAC) in exon 6 was changed to leucine (CTA) (c.557_558delACinsTA, p.H186L) using an sgRNA (targeting GAGCTCATGCACGTACTTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility. (J:342780)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count