Arginine codon 63 (CGT) in exon 4 was targeted for change to cysteine (TGT) (c.187C>T p.R63C) using an sgRNA (targeting TGAACGTCGCCAGGTCGCGG) and an ssODN template with CRISPR/Cas9 technology. This allele has an unintended 116 bp deletion of the 3' end of intron 3 and the 5' end of exon 4 (GRCm39:chr1:153411645-153411760). No transcripts are expressed from this allele. (J:342764)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count