Arginine codon 506 (CGA) in exon 14 was changed to a stop codon (TAA) (p.R506*) using an sgRNA (targeting GAGCGAATTTTACCCTCGAG) and an ssODN template with CRISPR/Cas9 technology. The mutation, which truncates the encoded peptide by 6 C-terminal amino acids, is the equivalent of the human NM_001693.3:c.1516C>T p.R506* mutation associated with autosomal dominant congenital deafness with onychodystrophy (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). (J:342781)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count