This allele from project TCPR0530 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence CTCTGTGGTGGGGCATTGCC and a single-strand oligonucleotde encoding a 3xFLAG tag followed by a flexible linker (GGGGS). The 3xFLAG-linker was inserted adjacent to the ATG codon of Smpd14 after Chr7:105554534. (J:322048)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count