This allele was generated at The Centre for Phenogenomics by injecting Cas9 protein and a synthetic crRNA with sequence CCGCAAAACUCAGCUUGCGA targeting the 5' side of exon ENSMUSE00000316434 and a single-strand oligonucleotide encoding a 3xHis tag. The 3xHis tag was inserted adjacent to the ATG codon of Prdm14 (c.3_4insCACCACCACCACCACCAC). (J:322048)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count